50k Marker Details

This page contains detailed information about a selected iSelect marker. Beside some general information an interactive report with BLAST results against morex contigs is available. Please use the search field for a free text search. To search within a specific column preselect the column by clicking on the magnifier symbol on the left. Additional options such as filtering and column sorting are available through the actions menu. To see more details please click on more details, which are located at The James Hutton Institute.

50k Marker:	JHI-Hv50k-2016-64
Locus Name:	JHI-Hv50k-2016-64
Sequence:	CAGGGACTCCGTAAATATTACCAGGGAGGATAGGTTTTCGCACTACCGCCCATTGGAGGA ACATGCCCCCTCCGCCGCAAGGAATGGTCAGTATATATATATTTARCATTTCACTTTGTT G
More details:	More Details

50k Marker	Locus Name	SNP Position (Locus)	Locus Length (bp)	AGP Chromosome	AGP Start	AGP End	SNP Position (AGP)	Orientation	Mapping Quality
JHI-Hv50k-2016-64	JHI-Hv50k-2016-64	61	121	chr1H	249,964	250,085	250,025	+	60

1 - 1

50k Marker	Locus Name	SNP Position (Locus)	Locus Length (bp)	AGP Chromosome	AGP Start	AGP End	SNP Position (AGP)	Orientation	Mapping Quality
JHI-Hv50k-2016-64	JHI-Hv50k-2016-64	61	121	chr1H	80,449	80,570	80,510	-	60

1 - 1

Help

50k Marker Details

50k Morex v2 (2019)

50k Morex v3 (2020)